MarpolBase - Negative regulation of conserved RSL class I bHLH transcription factors evolved independently among land plants.

Negative regulation of conserved RSL class I bHLH transcription factors evolved independently among land plants.

Honkanen, S., et al. · 2018 · eLIFE research

Gene ID	Name	Evidence / Role	Function (this paper)
Mp1g06440	MpFRH1	experimental subject	Identified by forward-genetic screen of few rhizoids T-DNA mutants and confirmed as a 21-nt miRNA (UGUGUGAGAAGAGGCCAAUGU); overexpression caused very few or no rhizoids in 88/103 plants. Acts as a negative regulator of rhizoid/gemma/mucilage-papilla development by cleaving MpRSL1 mRNA, with a target site 100% conserved across twelve liverworts.
Mp3g17930	MpRSL1	experimental subject	Shown by RLM-RACE to be the direct cleavage target of MpFRH1 miRNA, with reduced steady-state mRNA in all four MpFRH1GOF mutants. A miRNA-resistant MpRSL1res restored rhizoid/gemma development (88.9% vs 0%), and MpRSL1 positively feeds back on MpFRH1, forming a negative-feedback regulatory loop.
—	MpAPT1 missing	experimental tool	Used as an internal reference gene for qRT-PCR normalization (with MpCUL3).
—	MpCUL3 missing	experimental tool	Used as a second internal reference gene for qRT-PCR normalization (with MpAPT1).
Mp3g23400	MpEF1	experimental tool	Used as a constitutive promoter to drive MpRSL1 and MpRSL1res expression in transgenic rescue lines.
Mp5g17640	MpIRE	experimental tool	Its 3.5 kb promoter drove ubiquitous YFP as a control showing expression in both rhizoid and non-rhizoid precursor cells, contrasting MpFRH1's rhizoid-enriched pattern.