Mp1g06440



Description

Annotation

Database ID Description
MapolyID Mapoly0043s0036 -

Nomenclature

Gene symbol Product Transcript ID Status
MpFRH1 miRNA Published

Associated Literature (AI-based literature mining, Beta-version)

Identified by forward-genetic screen of few rhizoids T-DNA mutants and confirmed as a 21-nt miRNA (UGUGUGAGAAGAGGCCAAUGU); overexpression caused very few or no rhizoids in 88/103 plants. Acts as a negative regulator of rhizoid/gemma/mucilage-papilla development by cleaving MpRSL1 mRNA, with a target site 100% conserved across twelve liverworts.

3 core 7 peripheral

Mercadal J, Ferreira-Guerra M, Caño-Delgado AI, Ibañes M. (2026) · Cell reports  research experimental subject
The microRNA FRH1 (MpFRH1) mediates lateral inhibition by repressing RSL1; modeling shows FRH1 diffusion/mobility generates a diffusion-driven switch with a sharp transition between uniform and patterned states, associated with a subcritical Turing bifurcation at criticality.
Thamm, A., et al. (2019) · BioRxiv  research experimental subject
FEW RHIZOIDS1 miRNA; a repressor that inhibits MpRSL1 activity, mediating lateral inhibition to control rhizoid cell patterning. Mpfrh1 loss elevates MpRSL1 and rhizoid numbers.
Honkanen, S., et al. (2018) · eLIFE  research experimental subject
Identified by forward-genetic screen of few rhizoids T-DNA mutants and confirmed as a 21-nt miRNA (UGUGUGAGAAGAGGCCAAUGU); overexpression caused very few or no rhizoids in 88/103 plants. Acts as a negative regulator of rhizoid/gemma/mucilage-papilla development by cleaving MpRSL1 mRNA, with a target site 100% conserved across twelve liverworts.
Aggarwal, B., et al. (2024) · RNA Biology  research citation background
Cited from prior work as FEW RHIZOIDS1, characterized for rhizoid and gemma production control.
Pietrykowska, H., et al. (2023) · Plant Molecular Biology  review citation background
miRNA/tasiRNA target module (Pietrykowska 2023)

Expression Level powered by MBEX

Link to the original image in MBEX

Transcript models

Transcript ID Location Sequences Extract region
Mp1g06440.1 chr1:6974604..6978527 (+) Gene /  mRNA /  CDS /  Protein
FASTA / GenBank (with flanking bases)

Gene structure:

Sequences:

Gene UTR + CDS + intron

FASTA

mRNA UTR + CDS

FASTA

CDS

FASTA

Protein

FASTA


MarpolBase / Genome Informatics Lab. NIG.